What did the straight edge ghost say to the bartender?

No boos for me.

Previous Random Joke Next

Boo Jokes More Boo Jokes

What did the pirate's ghost say to his girlfriend?

I love your Boo-ty

Who's there Boo!! Boo who?

Don't cry, it's only a joke

Bartender Jokes More Bartender Jokes

Why the wrong face?

the bartender says.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.