What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

How does Sean Connery ask for Worchestershire sauce?

x-post from askreddit) Worsheshershershosh.

What's the best/worst dirty joke you know?

In honor of the recent joke trends I ask you what is the dirtiest joke you know?

Bartender Jokes More Bartender Jokes

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

What did the bartender say to the angry speaker?

We don't want any treble