What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What is Samsung PR team's Christmas jingle you ask?

The phone we gave you is frightful, But the fire is so delightful ; And since we have no replace to go, Let it blow! Let it blow! Let it blow!

How do you get a Canadian to quit smoking cigarets?

You ask him politely.

Bartender Jokes More Bartender Jokes

What in the world is this?

The bartender says, "Central Park."

What did the bartender say to the horse?

bartender: Why the long face Horse: My alcoholism is destroying my family.