Bartender Jokes

What's the difference between a mixologist and a bartender?

About ten minutes.

Couple's Daily Question Mug

5.0

Coffee Mug

How do you pay a bartender?

With bar tender.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.

What did the bartender say to the alien?

You're drunk ET, go home!"

Why would Bart Simpson never go to a pub?

Because there's a BartEnder there.

What did the drunk Chinese customer say to the bartender?

No have to cut me off. Fall off barstool by myself. end metajoke

Why does Jesus and bartenders have so much in common?

Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.

Why the long face ?

A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.

What do you call a bartender giving two dolphins a drink?

Serving dual porpoises!

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the straight edge ghost say to the bartender?

No boos for me.

Interactive Joke of the Day Mug

5.0

Coffee Mug

What did the bartender say to the horse?

bartender: Why the long face Horse: My alcoholism is destroying my family.

What will you be having to drink?

Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.

Why the wrong face?

the bartender says.

How much for a beer?

The bartender replies: "For you No charge."

What'll ya have?

Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.

What did the bartender say when oxygen, hydrogen, sulfur, sodium, and phosphorous walked into his bar?

OH SNaP!

What did the brown dwarf say to the bartender?

I'd like a Corona, please.

Why the sad face?

asks the bartender. "I got fired."

What did the bartender say to the jumper cables when they walked into the bar?

A: Ok you 2 dont start anything

How much for a drink?

The bartender replies, "For you No charge."

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.

What did the bartender say to the jumper cables?

You better not try to start anything.

Why the long pause?

asks the bartender. The bear replies "Well, I am a bear"

How'd ya get that?

asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.

What did the bartender say to the angry speaker?

We don't want any treble

What did the bartender say to the foreskin?

You're cut off."

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

When the neutron gets his drink, he asks, "Bartender, how much do I owe you?

The bartender replies, "For you, neutron, no charge."

Who's the new guy?

And the bartender says, I don't know, but I've heard he's a shady character!

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What can I get you ?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

What do you mean I can't drink alcohol with this medication?

You're not a bartender! You're just a pharmacist.

What in the world is this?

The bartender says, "Central Park."

When the bartender asks you what's in a Ryan Lochte?

Just say "I don't know, make something up"

When he finishes drinking, he pulls out his wallet and say to the Bartender, "How much?

The Bartender says, "For you No charge."

How much will that be?

asks the neutron. "For you " replies the bartender, "no charge."

What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

What did the bartender say to the gold when the gold walked into a bar?

AU, get outta here!"

How do you encourage a bartender?

That's the spirit!" How do you discourage a bartender Boos.

Where is all the color white?

Bartender says, "dude, this is a gray bar.

A ham sandwhich walks into a bar and orders a beer. The bartender says...

I'm sorry, we don't serve food here

A weasel walks into a bar. The bartender says, "Wow, I've never served a weasel before. What can I get for you?"

Pop,goes the weasel.

A DHCP packet walks into a bar and asks for a beer.

Bartender says, "here, but I’ll need that back in an hour!"

You might also enjoy:

Drink Jokes More Drink Jokes

Which beer did the flower drink that made it realize that it was smarter when it was young?

Budweiser

What's the difference between a tea bag and a used tampon?

What's the Difference between a tea bag and a used tampon - I dunno... - I'm never drinking tea at your house again then!

Minute Jokes More Minute Jokes

What was the most successful love story in Game of Thrones?

Shireen. She was only on Tinder for a couple of minutes.

Who's there ! Boiler ! Boiler who ?

Boiler egg for four minutes !

Girl Jokes More Girl Jokes

What do you call two girls having their menstrual cycles?

A menstrual bicycle.

Whats the difference between a girl and a washing machine?

When I dump a load in the washing machince, it doesnt follow me around

Alcoholism Jokes More Alcoholism Jokes

What's the difference between alcoholism and a lobotomy?

I'd rather have a bottle in front of me than a frontal lobotomy.

How do you prevent alcoholism?

Shots.

Pay Jokes More Pay Jokes

What did the man reply to his friend that found a good paying job taking care of mentally challenged people?

Answer: Oh, so it has its ups and downs.

What's the difference between a chickpea and a lentil?

I wouldn't pay 50 to have a lentil on my face...

Idk Jokes More Idk Jokes

What do you get when you mix an octopus with a black guy?

Idk but it sure as hell can pick cotton

What did Uranium-238 say to Helium when they first met?

IDK

Destroy Jokes More Destroy Jokes

Why is CoD like women?

Search and Destroy.

What did the robot say to the other robot as they destroyed each other?

Nothing personal."

Ice Jokes More Ice Jokes

What does batman take in his whiskey?

Just ice.

What does Batman put in his beverages?

Just ice.