He felt his presents.
Couple's Daily Question Mug
Coffee Mug
He didn't run, ewok-ed.
Don't you Leia finger on her
A Toyoda
Because he always uses the force.
Six foot force :)
He heard Obi-Wan in his head saying Out, I shall let myself.
A Toy-Yoda
Ewoks
It's because he was accused of cultural appropriation.
Char-Jar Binks
Interactive Joke of the Day Mug
Because Luke was looking for love in Alderaan places!!
Toyodas
Me 5: Me: Get some coffee
To which his friend replies, "No, it's about four and a half feet."
The feet.
To make a difference.
Islamophobia.
A nun with a spear through her head.
A: Because there are so many Wings and so many Wongs that someone's always Winging the Wong number.
He was charged with battery.
Him: The fact that you're calling ingredients tools means u shouldnt be in charge of this.
Because he came second.
They both love to spark up joints.
He is going to tell you.
Test-Tickle.
Use the fork, Luke.
Only a Sith deals in absolutes
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
the surgeon asked the patient that was about to be anesthetized. "But doc this is my first operation." "Really It's mine too and I am not excited at all."
