Isn't this using the internet backwards
Interactive Joke of the Day Mug
Coffee Mug
Subtract her clothes, divide her legs, give her a square root and watch her multiply.
So they can watch the battle
He wanted to see who would have the last laugh. back to work...
She wanted to be on time.
During PRIME time!
ME: I'm a *thinks back to the only game I watched* wide-retriever.
A: Pittsburg Steelers
A power strip.
Because his watch has ended.
Someone told him there were two Lucilles
Couple's Daily Question Mug
A mathador.
He wanted to watch the floor show. And why did he cover it back up ...He realized that he didn't want to watch the "hole" show.
That way they can both watch wrestling.
I'd totally watch hermit crab week if they had one.
Did you bring any snacks They want $5 for M&M's! I wanna go home Is it over yet - me watching my kids Christmas pageant
They both watch whales.
Easy. Lock them both in a trunk and watch who will be happier to see you after you open it in 15 minutes.
For the watch
Joe: I won it in a race. Bill: How many people participated in it Joe: Three a policeman the owner of the watch and me!!
Because he has a LED-TV.
They are both interesting to watch.
Hey, watch this.
In bits and pieces.
It takes four. One to screw in the bulb, and three others to watch and say, "Really dude, you look huge!"
A waist of time.
It was the best dam show I ever saw
It was very graphic!
Yes, but don’t turn it on.
So time would fly.
A president has never been blackmailed into treason over a video of him paying to have a Russian garbanzo bean on his face.
Quarkiplier
A hermit crab !
My neighbour isn't unknowingly raising two of my goats.
The same way that he got in !
By the way it Goebbels
Because 8 nined 10.
Ate Something! ("8 something", actually 8.306)
Programmer: I'm only here for the foo.....................d
Catholic
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Because his friend asked him when he thought they should cross.
When asked for his name by the coffee shop clerk, my brother-in-law answered, Marc, with a C. Minutes later, he was handed his coffee with his name written on the side: Cark.
Having to watch him do a half barrel roll over 8 of them. R.I.P. Bobby. Never forget.
They put a bottle of vodka 100 meters away from them.
OC) A bottle of scotch can keep beyond 27 years.
